Home Feedback Search Online Order CATALOG

International 

+32 (0) 16 58 90 45

+32 (0) 16 50 90 45

France

01 43 25 01 50

01 43 25 01 60

Italy

02 36 00 65 93

02 36 00 65 94

Germany 0241 6085 13140 0241 6085 33033

Japan

+81 78 386 2860

+81 78 306 0296

Back Up Next


 

 

Genekam

(note: Links to external site !!!)

A) PCR - Ready to use KITS*

 

We are updating our website ! If any information should be missing, please let us know.

All our PCR Kits contain primers, +ve control, negative control, nucleotide, buffers, loading dye and molecular marker (in case of RNA kit: it contains RNA to cDNA chemicals reverse-transcriptase, ribonuclease inhibitor, dNTP etc.). You have to add your DNA or RNA template to them. Our kits can be used with any good-quality thermocycler availale on the market. Our kits expire after 1 year, if they are stored at -20°C. All of our products are made in our laboratory in Germany. We can give you the certificate of German origin, as some countries may need this certificate.

How to use our genequencing service: Now you do not need to isolate the band from agarose, you can just send us 10 ul of PCR product in one tube (where you have seen the band), we can do the result. How to send the PCR product us is simple: just put 10 ul of PCR product in one microtube, close this tube and put in one envelop (there is no need of any ice or dry ice) . Please send this envelop to us. We will do the rest job and send you the sequence. We can help you also to interpret the results. The combination of the PCR with genesequencing will make your results 100% accurate. After that there will be no question about the accuracy of the test. This can be offered at the beginning, but later you have to send us the PCR in product in ready to use form or there will be some costs for the preparation of material for genesequencing. However we can help to prepare the material for genesequencing. It is easy to get the genesequencing done.

Here is the example of our Genesequencing as we made for one client for following avian influenza virus (H9N2) with our kit 122:
CAGAGCATGTTCAGGTTCATTCTACAGGAGTATGAGATGGCTGACT
CAAAAGAGCGGTTTTTACCCTGTTCAAGACGCCCAATACACAAAT

 

Bacteria & Parasites

Cat. No.

NAME OF READY TO USE PCR KIT

K 001 >

Mycoplasma detection in cell culture

K 002 > 

Mycoplasma bovis

K 003 > 

Mycoplasma mycoidis << manual

K 004 > 

Mycoplasma iowae >> technical details

K 005 > 

Mycoplasma meleagridis >> technical details

K 006 > 

Mycoplasma gallisepticum << manual
>> technical details

K 007 > 

Mycoplasma synoviae

K 008 > 

Mycoplasma agalactiae >> technical details

K 009 > 

Mycoplasma hyorhinis <<demo manual >> technical details

K 010 > 

Mycoplasma hyopneumoniae << manual

K 011 > 

Mycoplasma pneumoniae >> technical details

K 012 > 

Mycoplasma genitalium

K 040 > 

Mycoplasma hominis >> technical details

K 041 > 

Mycoplasma felis 

K 156 > 

Mycoplasma conjunctivae >> technical details

K 406 > 

Neisseria gonorrhoeae

K 013 > 

Chlamydia psittaci (including 1 free genesequencing)

K 014 > 

Chlamydia trachomatis (including 1 free genesequencing)

K 015 > 

Chlamydia pneumoniae <<demo manual
(including 1 free genesequencing)

K 016 > 

Campylobacter jejuni >> demo manual

K 017 > 

Leptospira

K 017A > 

Leptospira Pathogenic  >> technical details

K 018 > 

Borrelia burgdorferi

K 021 > 

Leishmania donovani <<demo manual

K 023 > 

Toxoplasma gondii

K 032 > 

Mycobacterium avium (subsp. paratuberculosis) DOUBLE CHECK
>> technical details

K 731 > 

Mycobacterium avium (subsp. paratuberculosis) SINGLE CHECK (IS900)

K 760 > 

Mycobacterium avium (subsp. avium)

K 033 > 

Mycobacterium bovis 

K 071 > 

Mycobacterium tuberculosis >>demo manual

K 155 >

Mycobacterium genavense (including 1 free sequencing)

K 716>

Mycobacterium leprae (DOUBLE CHECK) (without postive control) 

K 717>

Mycobacterium leprae (one step) (without postive control)
 
<< manual

K 718>

Mycobacterium genus

K 038>

Mycobacterium complex
(to differentiate between TB and non-TB) 

K 046 > 

Heliobacter pylori >> technical details

K 047 > 

Coxiella burnetii << demo manual

K 063 > 

Brucella abortus << demo manual

K 065 > 

Echinococcus granulosus 

K 067 > 

Acholeplasma laidlawi 

K 068 > 

Ureaplasma urealyticum  >> technical details

K 069 > 

Listeria monocytogenes >> demo manual

K 070 > 

Taylorella equigenitalis

K 076 > 

Legionella pneumoniae

K 714 > 

Legionella >> technical details

K 098 > 

Treponema pallidum

K 708 >

Yersinia enterocolitica   << manual

K 713 >

Rickettsia rickettsii   << manual

K 725 >

Giardia lamblia

K 726 >

Cyptosporidium

K 751 >

Pasteurella multocida

K 752 >

Pasteurella multocida (Toxigenic) >>technical details

K 732A >

Salmonella sp. 100 reactions >>technical details

K 732B >

Salmonella sp. 1000 reactions >>technical details

K 732C >

Salmonella sp. 10000 reactions >>technical details

K 741 >

Shigella (Shigellas dysenteriae) 100 reactions
 >>technical details

K 790 >

Staphylococcus genus

K 791 >

Staphylococcus aureus

K 792 >

Escherichia coli

K 118 >

Mycoplasma alkalescens

K 119 >

Mycoplasma bovirhinis

K 756A >

Campylobacter genus NEW

K 756B >

Campylobacter genus (with 2 sequencings) NEW

K 766 >

Mycoplasma mycoides cluster

K 767 >

Mycoplasma mycoides cluster & Mycoplasma agalactiae

K 768 >

Campylobacter fetus NEW

K 772A >

Brucella genus  NEW

K 772B >

Brucella genus (with 2 sequencings) NEW

 Fungi

Cat. No.

NAME OF READY TO USE PCR KIT

K 072 > 

Aspergillus fumigatus (incl. 2 free sequencings)

K 043 > 

Candida albicans

 K 106 >

Candida albicans + Aspergillus fumigatus + Fusarium

 K 107 >

Fusarium

K 108 >

Candida albicans + Aspergillus fumigatus

K 727 >

Pneumocystis carinii

 DNA-Viruses

Cat. No.

NAME OF READY TO USE PCR KIT

K 103 >

Cytomegalo virus  >> demo manual

K 104 >

Varicella-Zoster-Virus

K 091 >

Herpes simplex Virus 1+2 (Multiplex PCR)

K 092 >

Equine Herpes Virus 1+4 (Multiplex PCR)

K 093 >

Canine Herpes Virus

K 094 >

HBV with Genotyping A, B, C, D, E, F

K 095 >

HBV without Genotyping <<demo manual

K 120 >

FOWL POX (Poultry)

K 073 >

Feather disease virus (PBFD for parrots & birds

K 074 >

Avian Polyoma virus for parrots & birds >>demo manual

K 123 >

Koi Herpes Virus (KHV)

K 096 >

Feline Herpes Virus

K 114 >

BHV-1

K 125 >

Marek's disease <<demo manual

K 124 >

Polyoma and feather disease: MULTIPLEX PCR

K 706 >

Human Adeno Virus

K 707 >

Human Papilloma Virus (HPV 16 / 18)

K 709 >

Human Papilloma Virus Genotype

K 711 >

Porcine circovirus 2

K 115 >

Avian Infectious Laryngotracheitis (ILT)

K 742 >

Epstein-Barr Virus

K 091B >

Human Herpes virus (1-5), 100 reactions,  >>technical details

K 754 >

Human Herpes virus (1-8), 100 reactions

K 749 >

Human Polyoma Virus, 100 reactions >> technical details

  Blood parasites

Cat. No.

NAME OF READY TO USE PCR KIT

K 022 > 

Babesia gibsoni  >> technical details

K 078 > 

Babesia bovis  <<demo manual >> technical details

K 715 > 

Babesia bigemina

K 719 > 

Babesia cablli

K 720 > 

Babesia equi

K 201A > 

Plasmodium falciparum

K 201B > 

Plasmodium falciparum
(including 2 free genesequencings)

K 404 >

Plasmodium vivax

K 405 >

Plasmodium multiplex
+ Plasmodium vivax & Plasmodium falciparum

K 097 >

Anaplasma phagocytophilum >> technical details
>> manual

K 750 >

Theileria annulata (without positive control)

K 753 >

Theileria genus (without positive control)

 DNA-Tests

Cat. No.

NAME OF READY TO USE PCR KIT

K 019 >

Prothrombin + Factor V (human)

K 020 >

DNA Bird Sexing

K 024 >

Identification of species-specific DNA (bovine)

K 025 >

Identification of species-specific DNA (human)

K 026 >

Identification of species-specific DNA (ovine)   << manual

K 027 >

Identification of species-specific DNA (buffalo)

K 028 >

Identification of species-specific DNA (chicken)

K 029 >

Identification of species-specific DNA (porcine) << manual