Home Feedback Search Online Order CATALOG

International 

+32 (0) 16 58 90 45

+32 (0) 16 50 90 45

France

01 43 25 01 50

01 43 25 01 60

Italy

02 36 00 65 93

02 36 00 65 94

Germany

0241 6085 13140

0241 6085 33033

Back Up Next


 

 

Genekam

(note: Links to external site !!!)

A) PCR - Ready to use KITS*

 

We are updating our website ! If any information should be missing, please let us know.

All our PCR Kits contain primers, +ve control, negative control, nucleotide, buffers, loading dye and molecular marker (in case of RNA kit: it contains RNA to cDNA chemicals reverse-transcriptase, ribonuclease inhibitor, dNTP etc.). You have to add your DNA or RNA template to them. Our kits can be used with any good-quality thermocycler availale on the market. Our kits expire after 1 year, if they are stored at -20°C. All of our products are made in our laboratory in Germany. We can give you the certificate of German origin, as some countries may need this certificate.

How to use our genequencing service: Now you do not need to isolate the band from agarose, you can just send us 10 ul of PCR product in one tube (where you have seen the band), we can do the result. How to send the PCR product us is simple: just put 10 ul of PCR product in one microtube, close this tube and put in one envelop (there is no need of any ice or dry ice) . Please send this envelop to us. We will do the rest job and send you the sequence. We can help you also to interpret the results. The combination of the PCR with genesequencing will make your results 100% accurate. After that there will be no question about the accuracy of the test. This can be offered at the beginning, but later you have to send us the PCR in product in ready to use form or there will be some costs for the preparation of material for genesequencing. However we can help to prepare the material for genesequencing. It is easy to get the genesequencing done.

Here is the example of our Genesequencing as we made for one client for following avian influenza virus (H9N2) with our kit 122:
CAGAGCATGTTCAGGTTCATTCTACAGGAGTATGAGATGGCTGACT
CAAAAGAGCGGTTTTTACCCTGTTCAAGACGCCCAATACACAAAT

 

• Bacteria & Parasites

Cat. No.

NAME OF READY TO USE PCR KIT

K 001 >

Mycoplasma detection in cell culture

K 002 > 

Mycoplasma bovis

K 003 > 

Mycoplasma mycoidis << manual

K 004 > 

Mycoplasma iowae >> technical details

K 005 > 

Mycoplasma meleagridis >> technical details

K 006 > 

Mycoplasma gallisepticum << manual
>> technical details

K 007 > 

Mycoplasma synoviae

K 008 > 

Mycoplasma agalactiae >> technical details

K 009 > 

Mycoplasma hyorhinis <<demo manual >> technical details

K 010 > 

Mycoplasma hyopneumoniae << manual

K 011 > 

Mycoplasma pneumoniae >> technical details

K 012 > 

Mycoplasma genitalium

K 040 > 

Mycoplasma hominis >> technical details

K 041 > 

Mycoplasma felis 

K 156 > 

Mycoplasma conjunctivae >> technical details

K 406 > 

Neisseria gonorrhoeae

K 013 > 

Chlamydia psittaci (including 1 free genesequencing)

K 014 > 

Chlamydia trachomatis (including 1 free genesequencing)

K 015 > 

Chlamydia pneumoniae <<demo manual
(including 1 free genesequencing)

K 016 > 

Campylobacter jejuni >> demo manual

K 017 > 

Leptospira

K 017A > 

Leptospira Pathogenic  >> technical details

K 018 > 

Borrelia burgdorferi

K 021 > 

Leishmania donovani <<demo manual

K 023 > 

Toxoplasma gondii

K 032 > 

Mycobacterium avium (subsp. paratuberculosis) DOUBLE CHECK
>> technical details

K 731 > 

Mycobacterium avium (subsp. paratuberculosis) SINGLE CHECK (IS900)

K 760 > 

Mycobacterium avium (subsp. avium)

K 033 > 

Mycobacterium bovis 

K 071 > 

Mycobacterium tuberculosis >>demo manual

K 155 >

Mycobacterium genavense (including 1 free sequencing)

K 716>

Mycobacterium leprae (DOUBLE CHECK) (without postive control) 

K 717>

Mycobacterium leprae (one step) (without postive control)
 
<< manual

K 718>

Mycobacterium genus

K 038>

Mycobacterium complex
(to differentiate between TB and non-TB) 

K 046 > 

Heliobacter pylori >> technical details

K 047 > 

Coxiella burnetii << demo manual

K 063 > 

Brucella abortus << demo manual

K 065 > 

Echinococcus granulosus 

K 067 > 

Acholeplasma laidlawi 

K 068 > 

Ureaplasma urealyticum  >> technical details

K 069 > 

Listeria monocytogenes >> demo manual

K 070 > 

Taylorella equigenitalis

K 076 > 

Legionella pneumoniae

K 714 > 

Legionella >> technical details

K 098 > 

Treponema pallidum

K 708 >

Yersinia enterocolitica   << manual

K 713 >

Rickettsia rickettsii   << manual

K 725 >

Giardia lamblia

K 726 >

Cyptosporidium

K 751 >

Pasteurella multocida

K 752 >

Pasteurella multocida (Toxigenic) >>technical details

K 732A >

Salmonella sp. 100 reactions >>technical details

K 732B >

Salmonella sp. 1000 reactions >>technical details

K 732C >

Salmonella sp. 10000 reactions >>technical details

K 741 >

Shigella (Shigellas dysenteriae) 100 reactions
 >>technical details

K 790 >

Staphylococcus genus

K 791 >

Staphylococcus aureus

K 792 >

Escherichia coli

K 118 >

Mycoplasma alkalescens

K 119 >

Mycoplasma bovirhinis

K 756A >

Campylobacter genus NEW

K 756B >

Campylobacter genus (with 2 sequencings) NEW

K 766 >

Mycoplasma mycoides cluster

K 767 >

Mycoplasma mycoides cluster & Mycoplasma agalactiae

K 768 >

Campylobacter fetus NEW

K 772A >

Brucella genus  NEW

K 772B >

Brucella genus (with 2 sequencings) NEW

 • Fungi

Cat. No.

NAME OF READY TO USE PCR KIT

K 072 > 

Aspergillus fumigatus (incl. 2 free sequencings)

K 043 > 

Candida albicans

 K 106 >

Candida albicans + Aspergillus fumigatus + Fusarium

 K 107 >

Fusarium

K 108 >

Candida albicans + Aspergillus fumigatus

K 727 >

Pneumocystis carinii

 • DNA-Viruses

Cat. No.

NAME OF READY TO USE PCR KIT

K 103 >

Cytomegalo virus  >> demo manual

K 104 >

Varicella-Zoster-Virus

K 091 >

Herpes simplex Virus 1+2 (Multiplex PCR)

K 092 >

Equine Herpes Virus 1+4 (Multiplex PCR)

K 093 >

Canine Herpes Virus

K 094 >

HBV with Genotyping A, B, C, D, E, F

K 095 >

HBV without Genotyping <<demo manual

K 120 >

FOWL POX (Poultry)

K 073 >

Feather disease virus (PBFD for parrots & birds

K 074 >

Avian Polyoma virus for parrots & birds >>demo manual

K 123 >

Koi Herpes Virus (KHV)

K 096 >

Feline Herpes Virus

K 114 >

BHV-1

K 125 >

Marek's disease <<demo manual

K 124 >

Polyoma and feather disease: MULTIPLEX PCR

K 706 >

Human Adeno Virus

K 707 >

Human Papilloma Virus (HPV 16 / 18)

K 709 >

Human Papilloma Virus Genotype

K 711 >

Porcine circovirus 2

K 115 >

Avian Infectious Laryngotracheitis (ILT)

K 742 >

Epstein-Barr Virus

K 091B >

Human Herpes virus (1-5), 100 reactions,  >>technical details

K 754 >

Human Herpes virus (1-8), 100 reactions

K 749 >

Human Polyoma Virus, 100 reactions >> technical details

  • Blood parasites

Cat. No.

NAME OF READY TO USE PCR KIT

K 022 > 

Babesia gibsoni  >> technical details

K 078 > 

Babesia bovis  <<demo manual >> technical details

K 715 > 

Babesia bigemina

K 719 > 

Babesia cablli

K 720 > 

Babesia equi

K 201A > 

Plasmodium falciparum

K 201B > 

Plasmodium falciparum
(including 2 free genesequencings)

K 404 >

Plasmodium vivax

K 405 >

Plasmodium multiplex
+ Plasmodium vivax & Plasmodium falciparum

K 097 >

Anaplasma phagocytophilum >> technical details
>> manual

K 750 >

Theileria annulata (without positive control)

K 753 >

Theileria genus (without positive control)

 • DNA-Tests

Cat. No.

NAME OF READY TO USE PCR KIT

K 019 >

Prothrombin + Factor V (human)

K 020 >

DNA Bird Sexing

K 024 >

Identification of species-specific DNA (bovine)

K 025 >

Identification of species-specific DNA (human)

K 026 >

Identification of species-specific DNA (ovine)   << manual

K 027 >

Identification of species-specific DNA (buffalo)

K 028 >

Identification of species-specific DNA (chicken)

K 029 >

Identification of species-specific DNA (porcine) << manual     

K 035 >

Identification of species-specific DNA (fish) >> demo manual   

K 036 >

Identification of species-specific DNA (buffalo&cow)

K 603 >

Identification of species-specific DNA (horses)
(including 1 genesequencing)

K 703 >

Identification of species-specific DNA (cats)
(including 1 genesequencing)
  
<< manual

K 704 >

Identification of canine-specific DNA (dogs)

K 705 >

Identification of species-specific DNA (camels)

K 770 >

Identification of maize DNA

K 771 >

Identification of Soybean DNA

 • Tumor-Markers (RT-PCR)

cDNA Synthesis + cDNA PCR

Cat.No.

NAME OF READY TO USE PCR KIT

K 056 >

Mammaglobin 1 (human)

K 057 >

Mammaglobin 2 (human)

K 058 >

Mammaglobin 1&2 (human)

K 762 >

Human Mammaglobin

K 050 >

Human Cytokeratin 19 (K19)

K 051 >

Human Carcinoembryoic (CEA)

K 052 >

MART-1/MELAN-A (human)

K 053 >

MUC-1 (human)

K 054 >

MASPIN (human)

K 055 >

P53 (human)   under development

K 761A >

human β-Actin (internal control) NEW

K 761B >

human β-Actin (internal control): to be bought with any other tumor-marker kit.  NEW

K 763 >

Human Cytokeratin 20 (K20)  NEW

• Blood group

Cat.No.

NAME OF READY TO USE PCR KIT

K 773 >

ABO Genotyping, Human Blood group detection

 • RT-PCR for Viruses

cDNA Synthesis + cDNA PCR

Cat. No.

NAME OF READY TO USE PCR KIT

K 038 >

Rubella Virus (human)

K 037>

Hepatitis-C-Virus (HCV) 100 reactions, single check + nested

K 747A >

Hepatitis-C-Virus (HCV) 100 reactions, double check 

K 747B >

Hepatitis-C-Virus (HCV) 100 reactions, double check + 15 genesequencings  

K 034 >

Tick-borne encephalitis (TBE) (human) << technical details

K 039 >

Polio Virus (human)

K 049 >

Newcastle Disease (poultry) >> technical details

K 030 >

FIP (Feline infectious peritonitis)

K 042 >

PRRSV (porcine reproductive and respiratory syndrome virus)

K 059 >

Bovine viral diarrhoea virus (BVDV) >> technical details

K 764 >

Bovine viral diarrhoea virus 1 and 2 (Genotyping) NEW

K 060 >

Rotavirus  >> manual

K 061 >

Coxsackie virus

K 062 >

Parainfluenza virus 1,2,3

K 101A > 

Dengue Fever

K 101B > 

Dengue Fever (1-4)

K 101C > 

Dengue Fever (1-4) + 10 genesequencings

K 102 > 

Japanese Encephalitis Virus (JEV)

K 111 >

Bluetongue Virus (BTV)

K 113 >

Infectious bronchitis virus (IBV)

K 121 >

Infectious bursal disease (Gumboro disease) >>demo manual

K 122A

Avian influenza virus (H9, H5, N1)

K 122B >

Avian influenza virus (H9, H5, N1)
(incl. 2 free sequencings)

K 122C >

Avian influenza virus (H9, H5, N1)
(incl. 15 free gene sequencings)

K 122D >

Avian influenza virus (H3N2)

K 769 >

Avian influenza virus (H9) (incl. 2 free sequencings)

K 303 >

Influenza virus (H7N7) (incl. 5 free gene sequencings)

K 203A >

Influenza virus A

K 203B >

Influenza virus A (incl. 2 free gene sequencings)

K 400 >

Influenza virus B

K 712 >

Influenza Virus (H1N1)

K 123B >

Ready to use avian influenza virus (H5N1): human only
(incl. 2 free sequencings) DUPLEX PCR DOUBLE CHECK

K 127A >

DNA-Fluhunter: Avian Influenza virus H5, N1, H7 and H9

K 127B >

DNA-Fluhunter: Avian Influenza virus H5, N1, H7 and H9
(incl. 15 free genesequencings) 

K 177A >

DNA-Fluhunter: Avian Influenza virus H5N1 & H7

K 333A >

Avian Influenza H5N1 (one step) << manual

K 333B >

Avian Influenza H5N1 (one step) (incl. 2 free sequencings)

K 031 > 

Canine distemper Virus 

K 410A >

West Nile Virus (WNV)

K 410B >

West Nile Virus (WNV) + 2 genesequencings

K 412 > 

Yellow fever (YF) >> technical details

K 412B > 

Yellow fever (YF) + 10 free genesequencings)  >> technical details

K 412C > 

Yellow fever (YF) + 30 free genesequencings)  >> technical details

K 412D > 

Yellow fever (YF) + 70 free genesequencings)  >> technical details

K 734A >

Mosquito borne flaviviruses (universal solution): 100 reactions

K 734B >

Mosquito borne flaviviruses (universal solution): 100 reactions + 10 genesequencing

K 734C >

Mosquito borne flaviviruses (universal solution): 100 reactions + 30 genesequencing

K 734D >

Mosquito borne flaviviruses (universal solution): 100 reactions + 70 genesequencing

K 735A >

Classical swine fever virus (CSFV) DOUBLE CHECK
Pestivirus (CSFV, BVDV, BDV) + Classic swine fever virus

K 735B >

Classical swine fever virus (CSFV) DOUBLE CHECK
+ Pestivirus (CSFV, BVDV, BDV)
+ Classic swine fever virus + 2 genesequencing

K 710 >

Human respiratory syncytial virus - A & B (RSV)

K 748A >

Enterovirus >> technical details

K 748B >

Enterovirus + 15 genesequensings >> technical details

K 755 >

Mumps NEW

K 746A >

Rabies Virus NEW

K 746B >

Rabies Virus incl. 5 genesequencings NEW

• RNA Virus without positive control (Ready to use PCR kits)*

Cat.No.

NAME OF READY TO USE PCR KIT

K 722 >

Lassa virus (without positive control + free genesequencing)

K 723 >

Crimean-Congo haemorrhagic virus
(without positive control + free genesequencing)

K 724 >

Rift Valley fever (without positive control + free genesequencing)

K 728 >

Ebola or Marburg virus
(without positive control + free genesequencing)

K 721 >

SARS (without positive control + free genesequencing)

K 729 >

Foot-and-mouth-disease (FMD)
(without positive control + free genesequencing)

K 730 >

Rinderpest (without positive control + free genesequencing)

* only for research use

• Molecular Antibiotic Resistant Test

Cat. No.

NAME OF READY TO USE PCR KIT

K 080A >

MRSA Methicillin-resistent Staphylococcus aureus with internal control

K 080B>

MRSA with two internal controls:
Staphylococcus and Staphylococcus aureus

• Multiplex PCR (100 reactions)*

Cat. No.

NAME OF READY TO USE PCR KIT

K 738A > 

Mycoplasma synoviae + Mycoplasma gallisepticum
Multiplex PCR, 100 reactions

K 738B > 

Mycoplasma synoviae + Mycoplasma gallisepticum 
Multiplex PCR, 2000 reactions

K 739 > 

Mycoplasma hypopneumoniae + Mycoplasma hyorhinis
Multiplex PCR, 100 reactions

K 737 > 

Chlamydia pneumoniae + Chlamydia trachomatis
Multiplex PCR, 100 reactions

K 743 >

Epstein-Barr Virus + Cytomegalovirus  NEW
Multiplex PCR, 100 reactions

K 122E >

Avian influenza virus (H9, H5, N1)
Multiplex PCR, 200 reactions

K 767 >

Mycoplasma mycoides cluster & Mycoplasma agalactiae
Multiplex PCR, 100 reactions


B )Fluorogenic Realtime PCR  - Ready to use KITS (100 reactions)*

Our Realtime kits are compatible with all machines from ABI, Rotagene, Stratagene, Techne.

Cat. No.

NAME OF READY TO USE PCR KIT

FR 001 >

Leptospira pathogenic 100 reactions

FR 002 >

Coxiella burnetii 100 reactions << manual 
>> technical details
  

FR 003 >

Chlamydia pneumoniae 100 reactions >> manual
>> technical details

FR 004 >

Bordetella pertussis 100 reactions

FR 005 >

Influenza A virus 100 reactions

FR 006 >

Avian Influenza virus (H5) 100 reactions

FR 007 >

Human hepatitis B virus 100 reactions  << manual
>> technical details

FR 008 >

mtDNA (human) 100 reactions

FR 009 >

nDNA (human) 100 reactions

FR 010 >

Borrelia Burgdorferi 100 reactions
>> technical details

FR 011 >

Influenza B Virus 100 reactions

FR 012A >

Mycobacterium tuberculosis SINGLE CHECK: for 100 reactions
>> technical sheet

FR 012A >

Mycobacterium tuberculosis SINGLE CHECK:for 1000 reactions
>> technical sheet 

FR 013A >

Mycobacterium tuberculosis DOUBLE CHECK AND MULTIPLEX: 100 reactions
>> technical sheet  >> picture 1  >> picture 2  >> picture 3  >> picture 4

FR 013B >

Mycobacterium tuberculosis DOUBLE CHECK AND MULTIPLEX: 1000 reactions
>> technical sheet

FR 014A>

Mycobacterium avium sp. paratuberculosis for 100 reactions

FR 014B>

Mycobacterium avium sp. paratuberculosis for 1000 reactions

FR 015 >

Epstein-Barr Virus 100 reactions  >>technical details

FR 016 >

Cytomegalovirus 100 reactions  >> technical details

FR 017 >

Gram-negative bacteria 100 reactions

FR 018 >

Human Herpes Simplex Virus 1,  100 reactions >> technical details

FR 019 >

Human Herpes Simplex Virus 2  >> picture

FR 020 >

Varicella Zoster Virus

FR 021 >

Gram-positive Bacteria

FR 022 >

Avian Influenza virus (H7) 100 reactions

FR 023 >

Mammaglobin 100 reactions

FR 024 >

Human Herpes Simplex Virus 1 & 2 Multiplex
>> picture 1  >> picture 2

FR 025 >

Human Polyoma virus


C) Positive controls for PCR (DNA or cDNA)*

We have decided to offer the positive controls. Our positive controls contain the isolated DNA of microorganism i.e. these are purified DNA. This is only for PCR purpose. We have not really quantified the amount of DNA in the controls ( it might be around 50 ng or more or less in 100 ul solution and 60 ul for RNA), but it will be sufficient to be used as positive control for PCR method. At present we have the following controls:

CAT. NR. 

NAME

D0002

Mycoplasma pneumoniae >> manual

D0003

Borrelia burgdorferi

D0004

Toxoplasma gondii

D0005

Mycoplasma gallisepticum

D0006

Mycoplasma bovis

D0007

Leptospira

D0008

Helicobacter pylori

D0009

MRSA

D0010

Coxiella burnetii

D0011

Tick borne Encephalitis (TBE) virus (only RNA)

D0012

Rotavirus (only RNA)

D0013

Taylorella equigenitalis

D0015

Chlamydia trachomatis

D0016

Brucella melitensis

D0017

Brucella abortus

D0018

Cytomegalosvirus

D0019

Acholeplasma laidlawii

D0020

Ureaplasma urealyticum

D0021

Candida albicans

D0022

Bordetella pertussis

D0023

Borrelia garinii

D0024

Borrelia afzelii

D0025

Campylobacter fetus

D0026

Campylobacter jejuni

D0027

Epstein-Barr Virus

D0028

Legionella pneumoniae Serotype 1,2,3,4,5,6

D0029

Measles virus (only RNA)

D0030

Shigella (Shigella dysenteriae)

D0031

Rotavirus

D0032

Human adenovirus

D0033

Koi herpes virus

D0034

Chlamydia pneumoniae >> manual

D0035

Mycoplasma genitalium

D0036

Mycoplasma felis

D0037

Mycoplasma hominis

D0038

Mycoplasma hypopneumoniae

D0039

Mycoplasma iowae

D0040

Mycoplasma meleagridis

D0041

Mycoplasma mycoidis

D0042

Mycoplasma pneumoniae

D0043

Mycoplasma synoviae

D0044

Influenza Virus H1 (cDNA)

D0045

Influenza Virus H3 (cDNA)

D0046

Influenza Virus H5 (cDNA)

D0047

Influenza Virus H7 (cDNA)

D0048

Influenza Virus H9 (cDNA)

D0049

Influenza A (cDNA)

D0050

Influenza B (cDNA)

D0051

Parainfluenza (Human) (cDNA)

D0052

Dog specific DNA

D0053

Cat specific DNA

D0054

Camel specific DNA

D0055

Sheep specific DNA

D0056

Goat specific DNA

D0057

Kangaroo specific DNA

D0058

Bovine specific DNA

D0059

Porcine specific DNA

D0060

Mycobacterium tuberculosis

D0061

Mycobacterium avium sp. avium

D0062

Mycobacterium bovis

D0063

Mycobacterium intracellulare

D0064

Rat specific DNA

D0065

Mouse specific DNA

*only for research 
             
If you are looking for any postive control which is not listed here, please contact us for the information.

D) Total RNA from normal (healthy) tissue  NEW

- quality control
- certified to contain small RNA (miRNA, siRNA and snRNA)
- highest quality of RNA
- DNA removed through DNAse treatment
- source is healthy tissue
- Species:
mouse, rat, rabbit, (dog)
- 100ul = 100ug

CAT. NR. 

NAME

TRM001 >

brain total RNA, 100ul

TRM002 >

heart total RNA, 100ul

TRM003 >

liver total RNA, 100ul

TRM004 >

lung total RNA, 100ul

TRM005 >

spinal cord total RNA, 100ul

...
For complete list of total RNA products: >>> click here <<<

 

*only for research 

E) Tissue first-strand cDNA*:  NEW

We can offer you cDNA of different tissues of human, mouse, rat and rabbit. The price will be 50 reactions Euro 199,- per tissue like lung, liver, stomach, brain, kidney, heart, spleen and many more. Similarly we can offer you the cDNA of human tumors. The price will be based on 50 reactions. Please send us your inquiry with name of tissue or tumor and we send you the quotation.

CAT. NR. 

NAME

CDM001 >

brain cDNA, 50 reactions

CDM002 >

heart cDNA, 50 reactions

CDM003 >

liver cDNA, 50 reactions

CDM004 >

lung cDNA, 50 reactions

CDM005 >

spinal cord cDNA, 50 reactions

...
For complete list of cDNA products: >>> click here <<<

 

*only for research 

cDNA (first-strand cDNA) conversion Services: we offer services to generate cDNA. You can send us the tissue or probe in order to create the cDNA. We will isolate the RNA and convert this in cDNA. This price is depending on service and how difficult is the isolation from the tissue and conversion from the tissue. e.g. conversion of cDNA from liver tissue (tissue to be supplied from client) : RNA isolation + cDNA conversion : from Euro 69,- per probe (in case more than 2 probes: the price will be Minimum Euro 59,- per probe). Kindly ask for quotation. There will be shipping charges as we have to send the cDNA with dry ice. It will be sufficient to run 20 reactions, in case you give us sufficient material. In case you need this, kindly send us the request.

*only for research 

F)  Chemicals for PCR analysis

>>> Click here for more information
>>> Download: flyer about "chemicals for PCR analysis"

Cat No.

NAME OF READY TO USE PCR KIT

AMOUNT

SB0011

Genekam PCR Mastermix solution (2x)
>>technical manual

1ml

SB0012

Genekam PCR Mastermix solution (2x)
>>technical manual

10ml

SB0021

Genekam One Step RT-Master mix

30 reactions

SB0022

Genekam One Step RT-Master Mix
>>technical manual

200 reactions

SB0031

Genekam RT Master mix (cDNA Synthesis Kit)
>>manual

100 reactions

SB0041

Genekam loading dye (Blue)
>>technical manual

1ml

SB0042

Genekam loading dye (Blue)
>>technical manual

10 x 1ml

SB0051

Genekam TEA Buffer (50x)

1liter

SB0052

Genekam TEA Buffer (50x)

10 liter

SB0061

Genekam Generuler (100 bp)
>>technical manual

50 ug

SB0071

Genekam DNA isolation kit >>technical manual

250 reactions

SB0072

Genekam DNA isolation kit

1000 reactions

SB0073

Genekam DNA isolation kit

5000 reactions

SB0074

Genekam DNA isolation kit (per isolation, it will cost 11 cent)

10000 reactions

G)  Biodefence detection products  NEW

Please ask for complete information, as we can provide some solutions for these.

Cat No.

NAME

BIO001

Francisella tularensis

BIO002

Francisella tularensis and Francisella like

BIO003

Small pox

BIO004

Rinderpest

BIO005

Foot and mouth disease

BIO047

Coxiella burnetii

BIO007

Anthrax

H)  Education

Ready to use kits for Educational purpose: During the studies or schooling, everybody is being trained to use microscope. PCR is the microscope of the tomorrow, hence we have decided to bring the ready to use kits for Educational purposes so that the stundents learn right from the school, what is PCR ? What are advantage of the PCR ? What are the applications for PCR ?

Cat. No.

NAME OF READY TO USE PCR KIT

EDU 001 >

Ready to use PCR kit Education purpose (Basic )

EDU 002 >

Ready to use PCR kit Education purpose (Basic II)

EDU 003 >

Ready to use PCR kit Education purpose (Basic III)

EDU 004 >

Ready to use PCR kit Education purpose (Advance I)

EDU 005 >

Ready to use PCR kit Education purpose (Advance II)


Technical, contents and pricechanges, as well as typing errors and/or misprint and mistakes reserve. All Logos and brand names are property of the respective manufacturers. Our AGBs apply. Office hours: Mo - Fr from 10:00 to 16:00
 

 

For more information :: Bioxys and Gentaur BVBA :: Av. de l'Armιe 68 B4 :: BE-1040 BELGIUM

Email: info@gentaur.com
 

International 

+32 (0) 16 58 90 45

+32 (0) 16 50 90 45

France

01 43 25 01 50

01 43 25 01 60

Italy

02 36 00 65 93

02 36 00 65 94

Germany

0241 6085 13140

0241 6085 33033

Send mail to webmaster with questions or comments about this web site.
Copyright © 2005 Gentaur BVBA
Last modified: feb-07